Coding
Part:BBa_K4769208:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
gyrA coding sequence from B. subtilis 3610
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1816
Illegal SpeI site found at 2247 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1816
Illegal NheI site found at 2299
Illegal SpeI site found at 2247 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1816
Illegal BglII site found at 870
Illegal BglII site found at 1494 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1816
Illegal SpeI site found at 2247 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1816
Illegal SpeI site found at 2247
Illegal NgoMIV site found at 517
Illegal AgeI site found at 129 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 100
Illegal SapI.rc site found at 2389
Design Notes
N/A
Source
B. subtilis 3610 genome
Primers for cloning: FW: atgagtgaacaaaacacaccaca (+ desired overhangs) RV: tcacacttcttcttgttcttcttcattc (+ desired overhangs)